pEMS2155
(Plasmid #141065)

• Purpose: AAV plasmid with SYN1 promoter driving expression of EmGFP. Contains WPRE.
• Depositing Lab: Elizabeth Simpson
• Publication: Galvan et al Hum Gene Ther. 2021 Apr 16. doi: 10.1089/hum.2020.301.

Backbone

• Vector backbone: pEMS2157
• Backbone manufacturer: Simpson lab (deposited at Addgene)
• Modifications to backbone: addition of SYN1 promoter
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): SURE cells
• Growth instructions: “SURE” cells from Agilent, that the colonies are freshly picked, and the you limit the time to grow the culture. We typically transform the plasmid in the afternoon and take out the plate from the 37 degree incubator in the morning, we then pick the colonies and grow in LB for ~ 20 hrs
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SYN1-EmGFP-WPRE
• Alt name: Human Synapsin 1 Promoter - Emerald GFP - Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 2625
• Promoter: human Synapsin

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: FseI (not destroyed)
• 5′ sequencing primer: oEMS6098 (GCCATGCTCTAGGAAGATCG)
• 3′ sequencing primer: oEMS6126 (TCTCAGGCACGACACGACTC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

DNA synthesized at GenScript