- 
            PurposeE. coli-Lactobacilli shuttle vector containing SpCas9, tracrRNA, and a repeat-spacer-repeat array
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141095 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonecolE1, pAM beta
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Erythromycin, 200 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Gene/Insert 1
- 
                Gene/Insert nameCas9 and tracrRNA
- 
                    SpeciesS. pyogenes
- 
                  Insert Size (bp)4650
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATTATTAGGGGGAGAAGG
- 3′ sequencing primer TTTCGTTCATCCATAGTTGC (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert namerepeat-spacer-repeat array
- 
                  Insert Size (bp)302
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGTAATTTGTTTAATTGCCATTTCAATT
- 3′ sequencing primer GGAACTACAAAATAAATTATAAGGAGGC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            Article Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pCB578 was a gift from Chase Beisel (Addgene plasmid # 141095 ; http://n2t.net/addgene:141095 ; RRID:Addgene_141095)
- 
                For your References section: Genome Editing with CRISPR-Cas9 in Lactobacillus plantarum Revealed That Editing Outcomes Can Vary Across Strains and Between Methods. Leenay RT, Vento JM, Shah M, Martino ME, Leulier F, Beisel CL. Biotechnol J. 2019 Mar;14(3):e1700583. doi: 10.1002/biot.201700583. Epub 2018 Sep 20. 10.1002/biot.201700583 PubMed 30156038
 
    
