Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #141095)


Item Catalog # Description Quantity Price (USD)
Plasmid 141095 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9 and tracrRNA
  • Species
    S. pyogenes
  • Insert Size (bp)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATTATTAGGGGGAGAAGG
  • 3′ sequencing primer TTTCGTTCATCCATAGTTGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    repeat-spacer-repeat array
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB578 was a gift from Chase Beisel (Addgene plasmid # 141095 ; ; RRID:Addgene_141095)
  • For your References section:

    Genome Editing with CRISPR-Cas9 in Lactobacillus plantarum Revealed That Editing Outcomes Can Vary Across Strains and Between Methods. Leenay RT, Vento JM, Shah M, Martino ME, Leulier F, Beisel CL. Biotechnol J. 2019 Mar;14(3):e1700583. doi: 10.1002/biot.201700583. Epub 2018 Sep 20. 10.1002/biot.201700583 PubMed 30156038