fru-T2A-QF2 HDR plasmid
(Plasmid
#141099)
-
PurposePlasmid for CRISPR-generated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment into the coding sequence of the endogenous Aedes aegypti fru gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141099 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Vector typedonor template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namefru-left-HDR-arm; T2A-QF2-hsp70; 3xP3-dsRed-SV40; fru-right-HDR-arm
-
SpeciesSynthetic; Neurospora crassa, Discosoma sp., Aedes aegypti
-
Insert Size (bp)2569
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCATTATTATTGGTACCGGAATG
- 3′ sequencing primer GGCTTCGCCACTGTTTGCC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byQF2 was obtained from Chris Potter (e.g. Addgene plasmid #104876)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
fru-T2A-QF2 HDR plasmid was a gift from Leslie Vosshall (Addgene plasmid # 141099 ; http://n2t.net/addgene:141099 ; RRID:Addgene_141099) -
For your References section:
Fruitless mutant male mosquitoes gain attraction to human odor. Basrur NS, De Obaldia ME, Morita T, Herre M, von Heynitz RK, Tsitohay YN, Vosshall LB. Elife. 2020 Dec 7;9. pii: 63982. doi: 10.7554/eLife.63982. 10.7554/eLife.63982 PubMed 33284111