pSB3C5-phzSM
(Plasmid
#141105)
-
PurposeContains a phzS-phzM operon BioBrick
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 141105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB3C5
- Backbone size w/o insert (bp) 2695
- Total vector size (bp) 5042
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephzSM
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)2347
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer TGCCACCTGACGTCTAAGAA
- 3′ sequencing primer AGCCCCAATGATAACCCCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB3C5-phzSM was a gift from Martin Buck (Addgene plasmid # 141105 ; http://n2t.net/addgene:141105 ; RRID:Addgene_141105) -
For your References section:
Phenazines as model low-midpoint potential electron shuttles for photosynthetic bioelectrochemical systems. Clifford E, Bradley R, Wey L, Lawrence J, Chen X, Howe C and Zhang JZ.. Chem. Sci. (2021) 10.1039/D0SC05655C