RA35
(Plasmid
#141126)
-
PurposeExpresses dimeric LacI repressor (LacI-11) under Rhl promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC101
- Backbone size w/o insert (bp) 6484
- Total vector size (bp) 8280
-
Modifications to backbonespacer sequence between two inserts
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namedimeric LacI (LacI-11)
-
SpeciesSynthetic
-
Insert Size (bp)1047
-
Mutationtruncated/dimeric version of LacI (missing last 11 amino acids = tetramerization domain)
-
Entrez GenelacI (a.k.a. b0345, ECK0342)
- Promoter engineered rhl promoter (responds to C4-HSL)
-
Tag
/ Fusion Protein
- ssrA degradation tag (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TCCCAACCTTACCAGAGGGC
- 3′ sequencing primer TTGCGGGCAACTTCAGCA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameAiiA
-
Insert Size (bp)749
-
Entrez GeneAQ980_RS12585 (a.k.a. AQ980_RS12585, AQ980_12820)
- Promoter engineered xyl promoter (responds to xylose)
-
Tag
/ Fusion Protein
- ssrA degradation tag (C terminal on backbone)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer gaacggtttcactaggaagcaag
- 3′ sequencing primer TAGTGACCTGTTCGTTGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RA35 was a gift from Matthew Bennett (Addgene plasmid # 141126 ; http://n2t.net/addgene:141126 ; RRID:Addgene_141126) -
For your References section:
Majority sensing in synthetic microbial consortia. Alnahhas RN, Sadeghpour M, Chen Y, Frey AA, Ott W, Josic K, Bennett MR. Nat Commun. 2020 Jul 21;11(1):3659. doi: 10.1038/s41467-020-17475-z. 10.1038/s41467-020-17475-z PubMed 32694598