pAAV-Ef1a-FAS-GCaMP6f-WPRE
(Plasmid #141237)

• Purpose: AAV vector with Ef1a promoter and LoxFAS sites for Cre-Off expression of GCaMP6f (GCaMP6f will not be expressed in mammalian cells that express Cre recombinase)
• Depositing Lab: Guohong Cui
• Publication: Meng et al Neuron. 2018 May 16;98(4):707-717.e4. doi: 10.1016/j.neuron.2018.04.012. Epub 2018 May 3.

Backbone

• Vector backbone: pAAV-Ef1a-insert-WPRE-pA
• Backbone manufacturer: B. Sabatini Lab
• Backbone size w/o insert (bp): 5142
• Total vector size (bp): 6786
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GCaMP6f
• Insert Size (bp): 1362
• Promoter: Human elongation factor-1 alpha (EF-1 alpha)
• Tags / Fusion Proteins:
  • 6XHIS (N terminal on insert)
  • Xpress (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, XbaI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: Ef1a-F, tcaagcctcagacagtggttc
• 3′ sequencing primer: WPRE-R, GCAGCGTATCCACATAG

Resource Information

• Supplemental Documents:
  • pAAV-Ef1a-FAS-GCaMP6f-WPRE-pA.gbk
• A portion of this plasmid was derived from a plasmid made by: Douglas Kim (Addgene plasmid # 40755). Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen TW, Wardill TJ, Sun Y, Pulver SR, Renninger SL, Baohan A, Schreiter ER, Kerr RA, Orger MB, Jayaraman V, Looger LL, Svoboda K, Kim DS. Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354. 10.1038/nature12354 PubMed 23868258

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry