-
PurposeOE of DELE1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonesafe-harbor-expression
- Backbone size w/o insert (bp) 4366
- Total vector size (bp) 7882
-
Vector typeMammalian Expression
-
Selectable markersfluorescent
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDELE1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3516
-
Entrez GeneDELE1 (a.k.a. DELE, DELE1(L), KIAA0141)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mClover
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site speI (not destroyed)
- 3′ cloning site mluI (not destroyed)
- 5′ sequencing primer cattatacgaagttattcgacattg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXG289 was a gift from Martin Kampmann (Addgene plasmid # 141283 ; http://n2t.net/addgene:141283 ; RRID:Addgene_141283) -
For your References section:
Mitochondrial stress is relayed to the cytosol by an OMA1-DELE1-HRI pathway. Guo X, Aviles G, Liu Y, Tian R, Unger BA, Lin YT, Wiita AP, Xu K, Correia MA, Kampmann M. Nature. 2020 Mar;579(7799):427-432. doi: 10.1038/s41586-020-2078-2. Epub 2020 Mar 4. 10.1038/s41586-020-2078-2 PubMed 32132707