pET28a(+)::MBP-NL3F10H
(Plasmid
#141291)
-
PurposeMBP:NLUC:3xFlag:10xHis in pET-28 a (+) backbone for bacterial IPTG inducible expression (KmR)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 141291 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28 a (+)
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 7075
-
Vector typeBacterial Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BL21 DE3 Rossetta2 pLysS (Novagen, Merck, Darmstadt, Germany)
-
Growth instructionsLB media with 50 µg/ml Kanamycin (Kn50) and 34 µg/ml Chloramphenicol (Cm34). Incubate the plate over-night at 37 °C. The chloramphenicol relates to the bacterial strain (E. coli BL21 DE3 Rossetta2 pLysS) and not the plasmid itself
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMBP-NLUC3F10H
-
Alt nameNanoLuc
-
Alt nameNanoLUC
-
Alt nameNanoLuciferase
-
SpeciesSynthetic; Oplophorus gracilirostris
-
Insert Size (bp)1800
-
MutationEngineered for high stability (t1/2 = 11.5 days at 37 °C) and codon optimised for expression in mammalian cells.
- Promoter promoter for bacteriophage T7 RNA polymerase
-
Tags
/ Fusion Proteins
- Flag (x3) (C terminal on insert)
- His (x10) (C terminal on insert)
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmids pNL1.1 and pNL1.2 with NanoLUC sequence were kindly provided by Promega Corporation (UK, Delta House, Southampton Science Park, Southampton, SO16 7NS). The NanoLUC sequence was amplified, and cloned via a pET28a(+) (Novagen, Merck, Darmstadt, Germany) intermediate vector into a pUC19 vector carrying a 3× FLAG 10× His peptide as a C-terminal translational fusion, to form NanoLUC-3× FLAG-10× His (NL3F10H). The 3× FLAG-10His was chemically synthesised by Eurogentec (Seraing, Belgium). The tagged NanoLUC was amplified and cloned using Gibson assembly into pET28a(+) resulting in pET28a(+)::NL3F10H. A N-terminal tag comprising Maltose Binding Protein 6× His was fused to NanoLUC-3F10H, by amplifying the MBP-6× His from pMJ806 [38], resulting in pET28a(+)::MBP-NL3F10H.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a(+)::MBP-NL3F10H was a gift from Andrew Millar (Addgene plasmid # 141291 ; http://n2t.net/addgene:141291 ; RRID:Addgene_141291) -
For your References section:
Expanding the bioluminescent reporter toolkit for plant science with NanoLUC. Urquiza-Garcia U, Millar AJ. Plant Methods. 2019 Jul 8;15:68. doi: 10.1186/s13007-019-0454-4. eCollection 2019. 10.1186/s13007-019-0454-4 PubMed 31316580