pCryptDel4.8
(Plasmid #141293)

• Purpose: Plasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.
• Depositing Lab: Neel Joshi
• Publication: Kan et al ACS Synth Biol. 2020 Dec 10. doi: 10.1021/acssynbio.0c00466.

Backbone

• Vector backbone: pFREE
• Backbone manufacturer: Lauritsen et al. Microb. Cell Factories 16, (2017).
• Total vector size (bp): 7621
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: RelB
• Species: Escherichia coli Nissle 1917
• Insert Size (bp): 142
• GenBank ID: WP_001554710
• Promoter: Native promoter from pMUT2 relB/relE operon

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGAAACCTCAGGCATTTGAGAAGC

Gene/Insert 2

• Gene/Insert name: gRNA targetting pMUT2
• Species: Synthetic
• Insert Size (bp): 30
• Promoter: Prha (rhamnose inducible promoter)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: cccagtcagctccttccgg

Resource Information

• Supplemental Documents:
  • pCryptDel4_8.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry