Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pRU1099
(Plasmid #14464)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 14464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pbbr
  • Backbone size w/o insert (bp) 4500
  • Vector type
    Bacterial Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    unstable gfp-mut3.1 AAV
  • Species
    Aequorea
  • Insert Size (bp)
    717
  • GenBank ID
    aj851280

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer cggtttacaagcataaagc
  • 3′ sequencing primer TACTCATTTTTTCTTCCTCCACTAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Use gentamicin at 10 ug/mL.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRU1099 was a gift from Philip Poole (Addgene plasmid # 14464 ; http://n2t.net/addgene:14464 ; RRID:Addgene_14464)
  • For your References section:

    A family of promoter probe vectors incorporating autofluorescent and chromogenic reporter proteins for studying gene expression in Gram-negative bacteria. Karunakaran R, Mauchline TH, Hosie AH, Poole PS. Microbiology. 2005 Oct . 151(Pt 10):3249-56. 10.1099/mic.0.28311-0 PubMed 16207908