pIS56 NETO2 3'UTR mut
(Plasmid
#14496)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIS1
-
Backbone manufacturerBartel Lab
- Backbone size w/o insert (bp) 4085
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNETO2 3'UTR mutant
-
Alt nameNETO2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)510
-
MutationCATTCC’s were changed to AAGTAC's
-
Entrez GeneNETO2 (a.k.a. BTCL2, NEOT2)
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NETO2 3'UTR mutant in renilla luciferase reporter plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIS56 NETO2 3'UTR mut was a gift from David Bartel (Addgene plasmid # 14496 ; http://n2t.net/addgene:14496 ; RRID:Addgene_14496) -
For your References section:
Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193