Skip to main content
Addgene

pIS58 TIP120A 3'UTR mut
(Plasmid #14502)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14502 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIS1
  • Backbone manufacturer
    Bartel Lab
  • Backbone size w/o insert (bp) 4085
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TIP120A 3'UTR mutant
  • Alt name
    TIP120A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    80
  • Mutation
    CATTCC’s were changed to AAGTAC's
  • Entrez Gene
    CAND1 (a.k.a. TIP120, TIP120A)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

TIP120A 3'UTR mutant in renilla luciferase reporter plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIS58 TIP120A 3'UTR mut was a gift from David Bartel (Addgene plasmid # 14502 ; http://n2t.net/addgene:14502 ; RRID:Addgene_14502)
  • For your References section:

    Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193