Skip to main content

pAG30 IQGAP1 3'UTR mut
(Plasmid #14504)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14504 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIS2
  • Backbone manufacturer
    pIS2 derived from pRL-SV40 (Promega)
  • Backbone size w/o insert (bp) 3700
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IQGAP1 3'UTR mutant
  • Alt name
    IQGAP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    820
  • Mutation
    GTGCCTT was changed to GTGCGCC and GTGCCT was changed to GTCGGT
  • Entrez Gene
    IQGAP1 (a.k.a. HUMORFA01, SAR1, p195)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer EBV rev primer (GTGGTTTGTCCAAACTCATC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IQGAP1 3'UTR mutant in renilla luciferase reporter plasmid. There are several sequence discrepancies between Addgene's quality control sequence and depositor's sequence. Please refer to the Addgene sequence for the correct mutations.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAG30 IQGAP1 3'UTR mut was a gift from David Bartel (Addgene plasmid # 14504 ; http://n2t.net/addgene:14504 ; RRID:Addgene_14504)
  • For your References section:

    Microarray analysis shows that some microRNAs downregulate large numbers of target mRNAs. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM, Castle J, Bartel DP, Linsley PS, Johnson JM. Nature. 2005 Feb 17. 433(7027):769-73. 10.1038/nature03315 PubMed 15685193