pCI.neo-rPAM1-M314I
(Plasmid
#145802)
-
Purposeexpresses catalytically inactive rat PAM-1 in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCIS
-
Backbone manufacturerCornelia Gorman
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 8000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase)
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1350
-
Mutationchanged methionine 314 to isoleucine to inactivate monooxygenase activity
-
GenBank IDAAC05607.1
-
Entrez GenePam (a.k.a. PHM)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind3 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI.neo-rPAM1-M314I was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145802 ; http://n2t.net/addgene:145802 ; RRID:Addgene_145802) -
For your References section:
The catalytic core of peptidylglycine alpha-hydroxylating monooxygenase: investigation by site-directed mutagenesis, Cu X-ray absorption spectroscopy, and electron paramagnetic resonance. Eipper BA, Quon AS, Mains RE, Boswell JS, Blackburn NJ. Biochemistry. 1995 Mar 7;34(9):2857-65. doi: 10.1021/bi00009a016. 10.1021/bi00009a016 PubMed 7893699