pCI.neo-rPAM1-M314I
(Plasmid
#145802)
-
Purposeexpresses catalytically inactive rat PAM-1 in mammalian cells
-
Depositing Labs
-
Depositing OrganizationUniversity of Connecticut Health Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 145802-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 145802-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCIS
-
Backbone manufacturerCornelia Gorman
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 8000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase)
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1350
-
Mutationchanged methionine 314 to isoleucine to inactivate monooxygenase activity
-
GenBank IDAAC05607.1
-
Entrez GenePam (a.k.a. PHM)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind3 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGG
- 3′ sequencing primer GTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 145802-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 145802-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI.neo-rPAM1-M314I was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145802 ; http://n2t.net/addgene:145802 ; RRID:Addgene_145802) -
For your References section:
The catalytic core of peptidylglycine alpha-hydroxylating monooxygenase: investigation by site-directed mutagenesis, Cu X-ray absorption spectroscopy, and electron paramagnetic resonance. Eipper BA, Quon AS, Mains RE, Boswell JS, Blackburn NJ. Biochemistry. 1995 Mar 7;34(9):2857-65. doi: 10.1021/bi00009a016. 10.1021/bi00009a016 PubMed 7893699
Map uploaded by the depositor.
