Skip to main content

pCIS-rPAM3
(Plasmid #145803)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 145803 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCIS
  • Backbone manufacturer
    Cornelia Gorman
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7400
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rat PAM3
  • Alt name
    rPAM3
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2400
  • Mutation
    See depositor comments below
  • GenBank ID
    AAC05608.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Hind3 (not destroyed)
  • 3′ cloning site Xba1 (not destroyed)
  • 5′ sequencing primer CTTGAGGTGTGGCAGGCTTG
  • 3′ sequencing primer TGGTGTTGATCTTACGTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a Valine 221 deletion in rPAM3 compared to the NCBI reference sequence AAC05608.1. This deletion is not known to affect protein activity.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCIS-rPAM3 was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145803 ; http://n2t.net/addgene:145803 ; RRID:Addgene_145803)
  • For your References section:

    Differential trafficking of soluble and integral membrane secretory granule-associated proteins. Milgram SL, Eipper BA, Mains RE. J Cell Biol. 1994 Jan;124(1-2):33-41. doi: 10.1083/jcb.124.1.33. 10.1083/jcb.124.1.33 PubMed 8294504