pCIS-rPALcc
(Plasmid
#145804)
-
Purposeexpresses the catalytic core of rat peptidyl-hydroxyglycine-alpha-amidating lyase in mammalian cells
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 145804 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCIS
-
Backbone manufacturerCornelia Gorman
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase)
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1350
-
Mutationchanged serine 767 to alanine to prevent glycosylation
-
Entrez GenePam (a.k.a. PHM)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind3 (not destroyed)
- 3′ cloning site Xba1 (not destroyed)
- 5′ sequencing primer CTTGAGGTGTGGCAGGCTTG
- 3′ sequencing primer TGGTGTTGATCTTACGTCAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIS-rPALcc was a gift from Betty Eipper & Richard Mains (Addgene plasmid # 145804 ; http://n2t.net/addgene:145804 ; RRID:Addgene_145804) -
For your References section:
Essential features of the catalytic core of peptidyl-alpha-hydroxyglycine alpha-amidating lyase. Kolhekar AS, Bell J, Shiozaki EN, Jin L, Keutmann HT, Hand TA, Mains RE, Eipper BA. Biochemistry. 2002 Oct 15;41(41):12384-94. doi: 10.1021/bi0260280. 10.1021/bi0260280 PubMed 12369828