pCIS-rPALcc
(Plasmid #145804)

• Purpose: expresses the catalytic core of rat peptidyl-hydroxyglycine-alpha-amidating lyase in mammalian cells
• Depositing Labs: Betty Eipper, Richard Mains
• Publication: Kolhekar et al Biochemistry. 2002 Oct 15;41(41):12384-94. doi: 10.1021/bi0260280.

Backbone

• Vector backbone: pCIS
• Backbone manufacturer: Cornelia Gorman
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 6800
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: rat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase)
• Species: R. norvegicus (rat)
• Insert Size (bp): 1350
• Mutation: changed serine 767 to alanine to prevent glycosylation
• Entrez Gene: Pam (a.k.a. PHM)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Hind3 (not destroyed)
• 3′ cloning site: Xba1 (not destroyed)
• 5′ sequencing primer: CTTGAGGTGTGGCAGGCTTG
• 3′ sequencing primer: TGGTGTTGATCTTACGTCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry