Skip to main content

Rev CDK9 (D167N) (P#858)
(Plasmid #14635)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 14635 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSPORT-Rev
  • Backbone size w/o insert (bp) 4200
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cdk9 D167N
  • Alt name
    cyclin dependent kinase 9
  • Alt name
    cdk9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1100
  • Mutation
    D167N. Kinase negative mutant.
  • Entrez Gene
    CDK9 (a.k.a. C-2k, CDC2L4, CTK1, PITALRE, TAK)
  • Tag / Fusion Protein
    • Rev (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To construct pSPORTRev, Rev coding sequences (350 bp) were amplified by PCR from pcRev, restricted with AflII and SacI, and cloned into the PstI and SacI sites of pSV · SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker sequences .

CDK9 (D167N) was amplified by PCR from pRc/CMVCDK9D-NHA [pCDK9(D167N) with the oligonucleotides 5' GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGACTCGGT 3' (lowercase letters indicate the PvuII site) and 5' CAGACGGAGTTTGAGCGCGTCTTCCTCGAGAGGGGCCGGCG 3'. Amplified products (1.1 kbp) were restricted with PvuII and subcloned into pSPORTRev (PvuII).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Rev CDK9 (D167N) (P#858) was a gift from Matija Peterlin (Addgene plasmid # 14635 ; http://n2t.net/addgene:14635 ; RRID:Addgene_14635)
  • For your References section:

    The ability of positive transcription elongation factor B to transactivate human immunodeficiency virus transcription depends on a functional kinase domain, cyclin T1, and Tat. Fujinaga K, Cujec TP, Peng J, Garriga J, Price DH, Grana X, Peterlin BM. J Virol. 1998 Sep . 72(9):7154-9. PubMed 9696809