Rev CDK9 (D167N) (P#858)
(Plasmid
#14635)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 14635 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSPORT-Rev
- Backbone size w/o insert (bp) 4200
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecdk9 D167N
-
Alt namecyclin dependent kinase 9
-
Alt namecdk9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
MutationD167N. Kinase negative mutant.
-
Entrez GeneCDK9 (a.k.a. C-2k, CDC2L4, CTK1, PITALRE, TAK)
-
Tag
/ Fusion Protein
- Rev (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer SP6
- 3′ sequencing primer T7 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To construct pSPORTRev, Rev coding sequences (350 bp) were amplified by PCR from pcRev, restricted with AflII and SacI, and cloned into the PstI and SacI sites of pSV · SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker sequences .
CDK9 (D167N) was amplified by PCR from pRc/CMVCDK9D-NHA [pCDK9(D167N) with the oligonucleotides 5' GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGACTCGGT 3' (lowercase letters indicate the PvuII site) and 5' CAGACGGAGTTTGAGCGCGTCTTCCTCGAGAGGGGCCGGCG 3'. Amplified products (1.1 kbp) were restricted with PvuII and subcloned into pSPORTRev (PvuII).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Rev CDK9 (D167N) (P#858) was a gift from Matija Peterlin (Addgene plasmid # 14635 ; http://n2t.net/addgene:14635 ; RRID:Addgene_14635) -
For your References section:
The ability of positive transcription elongation factor B to transactivate human immunodeficiency virus transcription depends on a functional kinase domain, cyclin T1, and Tat. Fujinaga K, Cujec TP, Peng J, Garriga J, Price DH, Grana X, Peterlin BM. J Virol. 1998 Sep . 72(9):7154-9. PubMed 9696809
Map uploaded by the depositor.