Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Hmga2 3'UTR m4 luciferase (Luc-m4)
(Plasmid #14787)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 14787 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Available from Addgene (#12179)
  • Backbone size w/o insert (bp) 4000
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    m4 mutant (see article and author's map for details)
  • GenBank ID
  • Entrez Gene
    Hmga2 (a.k.a. 9430083A20Rik, HMGI-, HMGI-C, Hmgi, Hmgic, pg, pygmy)
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer EBV rev primer
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The 3' UTR of the mouse Hmga2 cDNA (BC052158) was subcloned into pCR2.1-TOPO (Invitrogen) for site-directed mutagenesis. To disrupt each let-7 complementary site, the nucleotides that paired to nucleotides 3 and 5 of the miRNA were substituted (see Author's map), using the Quikchange site-directed mutagenesis kit (Stratagene). To construct the Renilla luciferase reporters, wild-type and mutant Hmga2 3' UTRs were amplified (PCR primers, 5'-GCGTCTCGAGGGGCGCCGACATTC and 5'GGCGCGGCCGCAGTCAGAGGGCACAC) and cloned into the XbaI and NotI sites of pIS1.

Full sequence of wild-type plasmid available at Addgene plasmid #14785.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Hmga2 3'UTR m4 luciferase (Luc-m4) was a gift from David Bartel (Addgene plasmid # 14787 ; ; RRID:Addgene_14787)
  • For your References section:

    Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Mayr C, Hemann MT, Bartel DP. Science. 2007 Mar 16. 315(5818):1576-9. 10.1126/science.1137999 PubMed 17322030