pFCIV-CEACAM6
(Plasmid
#149303)
-
Purposelentiviral packaging vector for CEACAM6 expression.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149303 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonePFCIV
-
Backbone manufacturerHope Center for Neurological Disorders
- Backbone size w/o insert (bp) 10550
- Total vector size (bp) 11558
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBleo
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3 Genotype: F-mcrB mrrhsdS20(rB-, mB-) recA13 supE44 ara-14 galK2 lacY1 proA2 rpsL20(StrR) xyl-5 λ-leumtl-1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCEACAM6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1035
-
Entrez GeneCEACAM6 (a.k.a. CD66c, CEAL, NCA)
- Promoter ubiquitin C
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGACCCCCCTCAGCCCCTCCCTGCA
- 3′ sequencing primer TTATATCAGAGCCACCCTGGCCA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe CEACAM6 gene was cloned from pRC202454 (OriGene)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
the pFCIV vector was obtained from the Hope Center at Washington University. https://hopecenter.wustl.edu/?page_id=7068 PMC5008082
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFCIV-CEACAM6 was a gift from James Fleckenstein (Addgene plasmid # 149303 ; http://n2t.net/addgene:149303 ; RRID:Addgene_149303) -
For your References section:
CEACAMs serve as toxin-stimulated receptors for enterotoxigenic Escherichia coli. Sheikh A, Tumala B, Vickers TJ, Alvarado D, Ciorba MA, Bhuiyan TR, Qadri F, Singer BB, Fleckenstein JM. Proc Natl Acad Sci U S A. 2020 Nov 17;117(46):29055-29062. doi: 10.1073/pnas.2012480117. Epub 2020 Nov 2. 10.1073/pnas.2012480117 PubMed 33139570