Skip to main content

pME18S-F-R-Olfr160
(Plasmid #149366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149366 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pME18S
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Olfr160
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Olfr160 (a.k.a. M72, MOR171-3, Olfr7b)
  • Promoter SR alpha
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • rhodopsin (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer GGCCTGTACGGAAGTGTTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pME18S-F-R-Olfr160 was a gift from Takeshi Imai (Addgene plasmid # 149366 ; http://n2t.net/addgene:149366 ; RRID:Addgene_149366)
  • For your References section:

    Widespread Inhibition, Antagonism, and Synergy in Mouse Olfactory Sensory Neurons In Vivo. Inagaki S, Iwata R, Iwamoto M, Imai T. Cell Rep. 2020 Jun 30;31(13):107814. doi: 10.1016/j.celrep.2020.107814. 10.1016/j.celrep.2020.107814 PubMed 32610120