Skip to main content

pcDNA3-mem-TurboID
(Plasmid #149409)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149409 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Total vector size (bp) 6629
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mem-TurboID
  • Insert Size (bp)
    1254
  • Promoter CMV
  • Tags / Fusion Proteins
    • V5 (C terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-mem-TurboID was a gift from Jonathan Long (Addgene plasmid # 149409 ; http://n2t.net/addgene:149409 ; RRID:Addgene_149409)
  • For your References section:

    Cell type-selective secretome profiling in vivo. Wei W, Riley NM, Yang AC, Kim JT, Terrell SM, Li VL, Garcia-Contreras M, Bertozzi CR, Long JZ. Nat Chem Biol. 2021 Mar;17(3):326-334. doi: 10.1038/s41589-020-00698-y. Epub 2020 Nov 16. 10.1038/s41589-020-00698-y PubMed 33199915