pVD_79
(Plasmid
#149603)
-
Purpose(parent plasmid pCFB257) pX - 3 -LoxP -KlLEU2 -pTEF1 - TetR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 149603 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCFB257
- Backbone size w/o insert (bp) 6993
- Total vector size (bp) 8000
-
Vector typeYeast Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTetR
-
Insert Size (bp)627
- Promoter TEF1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gaaattcgcttatttagaagtgtc
- 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVD_79 was a gift from Michael Jensen (Addgene plasmid # 149603 ; http://n2t.net/addgene:149603 ; RRID:Addgene_149603) -
For your References section:
High-Resolution Scanning of Optimal Biosensor Reporter Promoters in Yeast. Ambri F, D'Ambrosio V, Di Blasi R, Maury J, Jacobsen SAB, McCloskey D, Jensen MK, Keasling JD. ACS Synth Biol. 2020 Feb 21;9(2):218-226. doi: 10.1021/acssynbio.9b00333. Epub 2020 Jan 31. 10.1021/acssynbio.9b00333 PubMed 31935067