Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pVD_01
(Plasmid #149606)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 149606 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS416
  • Backbone size w/o insert (bp) 5650
  • Total vector size (bp) 6385
  • Vector type
    Yeast Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VanR
  • Species
    Caulobacter crescentus
  • Insert Size (bp)
    735
  • Promoter TEF1

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gaaattcgcttatttagaagtgtc
  • 3′ sequencing primer CTCCTTCCTTTTCGGTTAGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVD_01 was a gift from Michael Jensen (Addgene plasmid # 149606 ; http://n2t.net/addgene:149606 ; RRID:Addgene_149606)
  • For your References section:

    High-Resolution Scanning of Optimal Biosensor Reporter Promoters in Yeast. Ambri F, D'Ambrosio V, Di Blasi R, Maury J, Jacobsen SAB, McCloskey D, Jensen MK, Keasling JD. ACS Synth Biol. 2020 Feb 21;9(2):218-226. doi: 10.1021/acssynbio.9b00333. Epub 2020 Jan 31. 10.1021/acssynbio.9b00333 PubMed 31935067