-
PurposeExpress doxycycline-inducible full length of human XIST cDNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149608 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRE3G
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3431
- Total vector size (bp) 18515
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameX-inactive specific transcript
-
Alt nameXIST
-
SpeciesH. sapiens (human)
-
Insert Size (bp)13730
-
GenBank IDNR_001564.2 NR_001564.2
-
Entrez GeneXIST (a.k.a. DXS1089, DXS399E, LINC00001, NCRNA00001, SXI1, swd66)
- Promoter pTRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PciI (destroyed during cloning)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GGAGCAGACATTCATATAGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The human XIST cDNA sequence modified and built into the DYRK1A/pTRE3G-FL-hXIST vector was based on an XIST cDNA initially cloned by Dr. Carolyn Brown (also an author on Jiang et al., Nature, 2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DYRK1A/pTRE3G-FL-hXIST was a gift from Jeanne Lawrence (Addgene plasmid # 149608 ; http://n2t.net/addgene:149608 ; RRID:Addgene_149608) -
For your References section:
Translating dosage compensation to trisomy 21. Jiang J, Jing Y, Cost GJ, Chiang JC, Kolpa HJ, Cotton AM, Carone DM, Carone BR, Shivak DA, Guschin DY, Pearl JR, Rebar EJ, Byron M, Gregory PD, Brown CJ, Urnov FD, Hall LL, Lawrence JB. Nature. 2013 Aug 15;500(7462):296-300. doi: 10.1038/nature12394. Epub 2013 Jul 17. 10.1038/nature12394 PubMed 23863942