Skip to main content

DYRK1A/pTRE3G-FL-hXIST
(Plasmid #149608)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 149608 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRE3G
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3431
  • Total vector size (bp) 18515
  • Vector type
    Mammalian Expression
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    X-inactive specific transcript
  • Alt name
    XIST
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    13730
  • GenBank ID
    NR_001564.2 NR_001564.2
  • Entrez Gene
    XIST (a.k.a. DXS1089, DXS399E, LINC00001, NCRNA00001, SXI1, swd66)
  • Promoter pTRE3G

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PciI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer GGAGCAGACATTCATATAGGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The human XIST cDNA sequence modified and built into the DYRK1A/pTRE3G-FL-hXIST vector was based on an XIST cDNA initially cloned by Dr. Carolyn Brown (also an author on Jiang et al., Nature, 2013).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    DYRK1A/pTRE3G-FL-hXIST was a gift from Jeanne Lawrence (Addgene plasmid # 149608 ; http://n2t.net/addgene:149608 ; RRID:Addgene_149608)
  • For your References section:

    Translating dosage compensation to trisomy 21. Jiang J, Jing Y, Cost GJ, Chiang JC, Kolpa HJ, Cotton AM, Carone DM, Carone BR, Shivak DA, Guschin DY, Pearl JR, Rebar EJ, Byron M, Gregory PD, Brown CJ, Urnov FD, Hall LL, Lawrence JB. Nature. 2013 Aug 15;500(7462):296-300. doi: 10.1038/nature12394. Epub 2013 Jul 17. 10.1038/nature12394 PubMed 23863942