pRSETb-tVYN-TmΔ
              
              
                (Plasmid
                
                #149694)
              
            
            
            
          - 
            PurposeHigh-copy plasmid to express the tVYN-TmΔ luminescent biosensor for in vitro purification
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 149694 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRSETb
- 
              Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 4726
- 
              Modifications to backboneInserted at NdeI/EcoRI
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameVenusΔC12-TmYcgRΔ-NLucΔ4
- 
                  Alt nametVYN-TmΔ
- 
                  Insert Size (bp)1965
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pRSETb-tVYN-TmΔ was a gift from Ming Hammond (Addgene plasmid # 149694 ; http://n2t.net/addgene:149694 ; RRID:Addgene_149694)
- 
                For your References section: Development of Ratiometric Bioluminescent Sensors for in Vivo Detection of Bacterial Signaling. Dippel AB, Anderson WA, Park JH, Yildiz FH, Hammond MC. ACS Chem Biol. 2020 Mar 25. doi: 10.1021/acschembio.9b00800. 10.1021/acschembio.9b00800 PubMed 32186367
