V43 pHIPPY GFP22
(Plasmid
#15097)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 15097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHIPPY
-
Backbone manufacturerMoon Lab
- Backbone size w/o insert (bp) 2167
-
Vector typeMammalian Expression, RNAi
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEGFP siRNA
-
gRNA/shRNA sequencegcaagctgaccctgaagttcat
-
Insert Size (bp)22
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (not destroyed)
- 3′ cloning site BsmBI (not destroyed)
- 5′ sequencing primer H1 primer (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Inhibits the expression of EGFP. Opposing human H1 and human U6 Pol III promoters drive expression of siRNAs
See article and author's map for more information. In the sequence link, the EGFP siRNA is lower case.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
V43 pHIPPY GFP22 was a gift from Randall Moon (Addgene plasmid # 15097) -
For your References section:
A plasmid-based system for expressing small interfering RNA libraries in mammalian cells. Kaykas A, Moon RT. BMC Cell Biol. 2004 Apr 30;5:16. doi: 10.1186/1471-2121-5-16. 10.1186/1471-2121-5-16 PubMed 15119963