pGL3-Enhancer-ZC3H12D_PromoterMUT
(Plasmid
#153068)
-
PurposeZC3H12D promoter region carrying mutations in BHLHE40 binding sites, cloned upstream of luciferase reporter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL3-Enhancer
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5059
- Total vector size (bp) 5694
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZC3H12D promoter region mutated in BHLHE40 binding sites
-
SpeciesH. sapiens (human)
-
Insert Size (bp)635
-
MutationMutagenesis to disrupt 3 BHLHE40 binding sites. New BamHI, EcoRI and EcoRV restriction sites were inserted by mutagenesis disrupting binding sites at position 185, 337 and 436 of the insert.
-
Entrez GeneZC3H12D (a.k.a. C6orf95, MCPIP4, TFL, dJ281H8.1, p34)
- Promoter None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Unavailable
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There exist several polymorphisms in the promoter region that do not functionally impact the plasmid. They represent discrepancies compared to the human reference genome (hg38).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Enhancer-ZC3H12D_PromoterMUT was a gift from Silvia Monticelli (Addgene plasmid # 153068 ; http://n2t.net/addgene:153068 ; RRID:Addgene_153068) -
For your References section:
A molecular network regulating the proinflammatory phenotype of human memory T lymphocytes. Emming S, Bianchi N, Polletti S, Balestrieri C, Leoni C, Montagner S, Chirichella M, Delaleu N, Natoli G, Monticelli S. Nat Immunol. 2020 Apr;21(4):388-399. doi: 10.1038/s41590-020-0622-8. Epub 2020 Mar 16. 10.1038/s41590-020-0622-8 PubMed 32205878