pAM-AAV-mSncg-Cre
(Plasmid
#153207)
-
PurposeMouse gamma-synuclein (mSncg) promoter-mediates Cre expression in retinal ganglion cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5816
- Total vector size (bp) 6845
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCre
-
Insert Size (bp)1029
- Promoter mSncg
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer gcaaacaccatggacgtcttcaaggaattcGCCACCATGcccaagaagaagaggaaggtg
- 3′ sequencing primer ccgggtcgactctagaggtaccacgcgtagatctctaatcgccatcttccagcaggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-AAV-mSncg-Cre was a gift from Yang Hu (Addgene plasmid # 153207 ; http://n2t.net/addgene:153207 ; RRID:Addgene_153207) -
For your References section:
Mouse gamma-Synuclein Promoter-Mediated Gene Expression and Editing in Mammalian Retinal Ganglion Cells. Wang Q, Zhuang PS, Huang H, Li L, Liu L, Webber HC, Dalal R, Siew L, Fligor CM, Chang KC, Nahmou M, Kreymerman A, Sun Y, Meyer JS, Goldberg JL, Hu Y. J Neurosci. 2020 Apr 9. pii: JNEUROSCI.0102-20.2020. doi: 10.1523/JNEUROSCI.0102-20.2020. 10.1523/JNEUROSCI.0102-20.2020 PubMed 32300046