pLVX-Phi3-GPR3-PGK-mCherry
(Plasmid
#153317)
-
PurposeExpresses GPR3 and mCherry in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLVX-Che-hi3
-
Backbone manufacturerSanford Simon
- Backbone size w/o insert (bp) 8230
- Total vector size (bp) 9229
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGPR3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)993
-
Entrez GeneGPR3 (a.k.a. ACCA)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (not destroyed)
- 3′ cloning site BAMH1 (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CTTTTGAAGCGTGCAGAATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #66350
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVX-Phi3-GPR3-PGK-mCherry was a gift from Robert Judson-Torres (Addgene plasmid # 153317 ; http://n2t.net/addgene:153317 ; RRID:Addgene_153317) -
For your References section:
BRAF(V600E) induces reversible mitotic arrest in human melanocytes via microrna-mediated suppression of AURKB. McNeal AS, Belote RL, Zeng H, Urquijo M, Barker K, Torres R, Curtin M, Shain AH, Andtbacka RH, Holmen S, Lum DH, McCalmont TH, VanBrocklin MW, Grossman D, Wei ML, Lang UE, Judson-Torres RL. Elife. 2021 Nov 23;10. pii: 70385. doi: 10.7554/eLife.70385. 10.7554/eLife.70385 PubMed 34812139