Skip to main content
Addgene
Open Menu

pROM-POU3F2p-mCherry-Neo
(Plasmid #153321)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 153321 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Add to Cart

Backbone

  • Vector backbone
    pROM
  • Backbone manufacturer
    Judson-Torres lab
  • Backbone size w/o insert (bp) 7935
  • Total vector size (bp) 8947
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    POU3F2 Promoter
  • Alt name
    BRN2 Promoter
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1012
  • Entrez Gene
    POU3F2 (a.k.a. BRN2, N-Oct3, OCT7, OTF-7, OTF7, POUF3, brn-2, oct-7)
  • Promoter N/A

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
  • 3′ sequencing primer CCATGTTATCCTCCTCGCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2020.08.26.269126 for the bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pROM-POU3F2p-mCherry-Neo was a gift from Robert Judson-Torres (Addgene plasmid # 153321 ; http://n2t.net/addgene:153321 ; RRID:Addgene_153321)

  • For your References section:

    A BRN2:MYC transcriptional axis regulates interconversion between therapy-resistant and tumorigenic phenotypes in melanoma. Zhang Y, Belote RL, Urquijo MA, Hansen MMK, Hejna M, Moustafa TE, Liu T , Lange D , Vand-Rajabpour F, Chang M, Lohman BK, Stubben C, Zhang X, Weinberger LS, VanBrocklin MW, Grossman D , Lex A, Kulkarni R , Zangle T, Judson-Torres RL. Cell Reports (2025) 10.1016/j.celrep.2025.116675
Related items: