pROM-POU3F2p-mCherry-Neo
(Plasmid
#153321)
-
PurposeExpresses mCherry from the POU3F2 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepROM
-
Backbone manufacturerJudson-Torres lab
- Backbone size w/o insert (bp) 7935
- Total vector size (bp) 8947
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePOU3F2 Promoter
-
Alt nameBRN2 Promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1012
-
Entrez GenePOU3F2 (a.k.a. BRN2, N-Oct3, OCT7, OTF-7, OTF7, POUF3, brn-2, oct-7)
- Promoter N/A
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GGTACAGTGCAGGGGAAAGA
- 3′ sequencing primer CCATGTTATCCTCCTCGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.08.26.269126 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pROM-POU3F2p-mCherry-Neo was a gift from Robert Judson-Torres (Addgene plasmid # 153321 ; http://n2t.net/addgene:153321 ; RRID:Addgene_153321) -
For your References section:
A BRN2:MYC transcriptional axis regulates interconversion between therapy-resistant and tumorigenic phenotypes in melanoma. Zhang Y, Urquijo MA, Zitnay RG, Marks K, Belote RL, Hansen MMK, Ferita M, Neuendorf HM, Liu T, Smith EA, Mehrabad EM, Hejna M, Moustafa TE, Lange D, Hu M, Vand-Rajabpour F, Done A, Becker CA, Lieberman M, Chang M, Lohman BK, Stubben CJ, Reeves MQ, Zhang X, Weinberger LS, VanBrocklin MW, Deacon DC, Grossman D, Spike BT, Lex A, Boyle GM, Kulkarni R, Zangle TA, Judson-Torres RL. Cell Rep. 2025 Dec 23;44(12):116675. doi: 10.1016/j.celrep.2025.116675. Epub 2025 Dec 15. 10.1016/j.celrep.2025.116675 PubMed 41405996