pSb_init containing  anti SARS-CoV-2_RBD sybody Sb#15
              
              
                (Plasmid
                
                #153523)
              
            
            
            
          - 
            PurposeExpression of the anti SARS-CoV-2_RBD sybody Sb#15
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information- 
                  Sequences (2) — Accept Affinity Reagent Sequence Policy
 
- 
                  
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepSB_init
- 
              Vector typeBacterial Expression
Growth in Bacteria
- 
            Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberLow Copy
Gene/Insert
- 
                Gene/Insert nameSb#15
- 
                    SpeciesSynthetic
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (unknown if destroyed)
- 3′ cloning site BspQI (unknown if destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.04.16.045419v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSb_init containing anti SARS-CoV-2_RBD sybody Sb#15 was a gift from Markus Seeger (Addgene plasmid # 153523 ; http://n2t.net/addgene:153523 ; RRID:Addgene_153523)
- 
                For your References section: Synthetic nanobodies targeting the SARS-CoV-2 receptor-binding domain. Walter JD, Hutter CAJ, Zimmermann I, Earp JD, Egloff P, Sorgenfrei M, Hürlimann LM, Gonda I, Meier G, Remm S, Thavarasah S, Plattet P, Seeger MA. bioRxiv 2020.04.16.045419 10.1101/2020.04.16.045419
 
    
