PDI-QUAD-V5-pcDNA3.1
(Plasmid
#153550)
-
PurposePDI-QUAD was generated from PDI-WT pcDNA3.1 (+) using two native active sites (CGHC, CGHC) tagged with V5, and mutated (to SGHS, SGHS) using site directed mutagenesis.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 153550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein disulphide isomerase
-
Alt namePDI-QUAD
-
SpeciesH. sapiens (human)
-
MutationC53S, C56S, C397S, C400S
- Promoter pCMV
-
Tag
/ Fusion Protein
- V5 tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CTCGACAAAGATGGGGTTGT
- 3′ sequencing primer -TGCTCAGTTTGCCCGTCATAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PDI-QUAD-V5-pcDNA3.1 was a gift from Julie Atkin (Addgene plasmid # 153550 ; http://n2t.net/addgene:153550 ; RRID:Addgene_153550) -
For your References section:
The Redox Activity of Protein Disulfide Isomerase Inhibits ALS Phenotypes in Cellular and Zebrafish Models. Parakh S, Shadfar S, Perri ER, Ragagnin AMG, Piattoni CV, Fogolin MB, Yuan KC, Shahheydari H, Don EK, Thomas CJ, Hong Y, Comini MA, Laird AS, Spencer DM, Atkin JD. iScience. 2020 May 22;23(5):101097. doi: 10.1016/j.isci.2020.101097. Epub 2020 Apr 25. 10.1016/j.isci.2020.101097 PubMed 32446203