pcDNA3.3-3XFLAG-AGO1
(Plasmid
#153556)
-
Purposeargonaute RISC Catalytic Component 1 (AGO1 Human)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 153556 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.3
- Backbone size w/o insert (bp) 5494
- Total vector size (bp) 8065
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameargonaute RISC Catalytic Component 1
-
Alt nameAGO1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2571
-
Entrez GeneAGO1 (a.k.a. EIF2C, EIF2C1, GERP95, NEDLBAS, Q99, hAgo1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3XFLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATAATACCGCGCCACATAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.3-3XFLAG-AGO1 was a gift from David Bartel (Addgene plasmid # 153556 ; http://n2t.net/addgene:153556 ; RRID:Addgene_153556) -
For your References section:
The biochemical basis for the cooperative action of microRNAs. Briskin D, Wang PY, Bartel DP. Proc Natl Acad Sci U S A. 2020 Jul 28;117(30):17764-17774. doi: 10.1073/pnas.1920404117. Epub 2020 Jul 13. 10.1073/pnas.1920404117 PubMed 32661162