Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRVGP-BB
(Plasmid #15380)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 15380 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRVGP
  • Backbone manufacturer
    Smale lab
  • Backbone size w/o insert (bp) 8017
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    mU6-BRG/BRM shRNA
  • Alt name
    BRG1
  • Alt name
    BRM
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    340
  • Entrez Gene
    Smarca4 (a.k.a. BAF190A, Brg1, HP1-BP72, SNF2beta, SW1/SNF, b2b508.1Clo, b2b692Clo)
  • Entrez Gene
    Smarca2 (a.k.a. 2610209L14Rik, SNF2alpha, Snf, Snf2l2, br, brahma, brm)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site NheI (destroyed during cloning)
  • 5′ sequencing primer gttcctgaccttgatctgaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mouse U6 promoter followed by short hairpin RNA against mouse BRG/BRM genes. Target sequence: TGGAGAAGCAGCAGAAGATT.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVGP-BB was a gift from Stephen Smale (Addgene plasmid # 15380 ; http://n2t.net/addgene:15380 ; RRID:Addgene_15380)
  • For your References section:

    Selective and antagonistic functions of SWI/SNF and Mi-2beta nucleosome remodeling complexes during an inflammatory response. Ramirez-Carrozzi VR, Nazarian AA, Li CC, Gore SL, Sridharan R, Imbalzano AN, Smale ST. Genes Dev. 2006 Feb 1. 20(3):282-96. 10.1101/gad.1383206 PubMed 16452502