Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCsy1-Csy2
(Plasmid #153942)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153942 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px601
  • Backbone size w/o insert (bp) 3178
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Csy1, Csy2
  • Species
    Synthetic; Pseudomonas aeruginosa
  • Insert Size (bp)
    1401
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TCCAAACTCATCAATGTATC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCsy1-Csy2 was a gift from Zhou Songyang (Addgene plasmid # 153942 ; http://n2t.net/addgene:153942 ; RRID:Addgene_153942)
  • For your References section:

    Repurposing type I-F CRISPR-Cas system as a transcriptional activation tool in human cells. Chen Y, Liu J, Zhi S, Zheng Q, Ma W, Huang J, Liu Y, Liu D, Liang P, Songyang Z. Nat Commun. 2020 Jun 19;11(1):3136. doi: 10.1038/s41467-020-16880-8. 10.1038/s41467-020-16880-8 PubMed 32561716