Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #153943)


Item Catalog # Description Quantity Price (USD)
Plasmid 153943 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3178
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Csy3-VPR, Csy4
  • Species
    Synthetic; Pseudomonas aeruginosa
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TCCAAACTCATCAATGTATC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCsy3-VPR-Csy4 was a gift from Zhou Songyang (Addgene plasmid # 153943 ; ; RRID:Addgene_153943)
  • For your References section:

    Repurposing type I-F CRISPR-Cas system as a transcriptional activation tool in human cells. Chen Y, Liu J, Zhi S, Zheng Q, Ma W, Huang J, Liu Y, Liu D, Liang P, Songyang Z. Nat Commun. 2020 Jun 19;11(1):3136. doi: 10.1038/s41467-020-16880-8. 10.1038/s41467-020-16880-8 PubMed 32561716