LeGO-Luc2
(Plasmid
#154006)
-
PurposeLentiviral vector expressing firefly luciferase (Luc2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLeGO vector
-
Backbone manufacturerKristoffer Riecken
- Backbone size w/o insert (bp) 6395
- Total vector size (bp) 8048
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsAny E. coli strain used for cloning should work (Top10, XL10gold, DH10B or other).
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
Alt nameLuc2
-
SpeciesFirefly
-
Insert Size (bp)1653
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAGCTCACAACCCCTCACTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a 3rd generation SIN lentiviral vector, expressing firefly luciferase (variant Luc2). The SFFV promoter is a strong and ubiquitous viral promoter derived from spleen focus-forming virus, working in murine and human cells. For packaging, use 2nd or 3rd generation packaging plasmids.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LeGO-Luc2 was a gift from Boris Fehse (Addgene plasmid # 154006 ; http://n2t.net/addgene:154006 ; RRID:Addgene_154006) -
For your References section:
A High-Throughput HIV-1 Drug Screening Platform, Based on Lentiviral Vectors and Compatible with Biosafety Level-1. Ellinger B, Pohlmann D, Woens J, Jakel FM, Reinshagen J, Stocking C, Prassolov VS, Fehse B, Riecken K. Viruses. 2020 May 25;12(5). pii: v12050580. doi: 10.3390/v12050580. 10.3390/v12050580 PubMed 32466195