pAKW.031-GM-R5
(Plasmid
#154044)
-
PurposeExpresses R5 peptide in E. coli
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154044 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC18
-
Backbone manufacturerAgilent
- Backbone size w/o insert (bp) 2385
- Total vector size (bp) 3653
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSilaffin R5 peptide
-
Alt nameMBP-His-TEV-R5
-
Alt nameR5
-
SpeciesCylindrotheca fusiformis
-
Insert Size (bp)1236
-
GenBank IDAF191634
- Promoter T7
-
Tag
/ Fusion Protein
- Maltose binding protein and his tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATCGGTGATGTCGGCGATATAG
- 3′ sequencing primer CACACCCGCCGCGCTTAATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAKW.031-GM-R5 was a gift from Christopher Voigt (Addgene plasmid # 154044 ; http://n2t.net/addgene:154044 ; RRID:Addgene_154044) -
For your References section:
Silica Nanostructures Produced Using Diatom Peptides with Designed Post-Translational Modifications. Wallace AK, Chanut N, Voigt CA. Advanced Functional Materials 2020 10.1002/adfm.202000849