Skip to main content

pNB1-LOX
(Plasmid #154058)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154058 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH47751
  • Backbone size w/o insert (bp) 4356
  • Total vector size (bp) 10545
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LoxP-flanked GUS and TtNAM-B1
  • Alt name
    ZmUbi::loxP-GUS-nosT-loxP-NAM-B1-nosT
  • Species
    Triticum turgidum ssp. dicoccoides (NAM-B1) and Escherichia coli (GUS)
  • Insert Size (bp)
    6169
  • Mutation
    The TtNAM-B1 gene sequence was domesticated to remove any BbsI or BsaI sites. One BbsI site was identified and was domesticated from “GTCTTC” to “ATCGTC”, removing the enzyme cut site but retaining the correct amino acid sequence. The exonic sequence is based on the sequence of NAM-B1 from T. turgidum ssp. dicoccoides, while the intronic sequence is taken from the non-functional copy of NAM-B1 present in Chinese Spring.
  • GenBank ID
    DQ869673.1
  • Promoter ZmUbi

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
  • 3′ sequencing primer GAACCCTGTGGTTGGCATGCACATAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The promoter sequence and 5' UTR are derived from pICSL12009, the GUS coding sequence is derived from pICH7511, both shared by Nicola Patron. The LoxP sites are derived from the ENSA construct EC10161.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB1-LOX was a gift from Cristobal Uauy (Addgene plasmid # 154058 ; http://n2t.net/addgene:154058 ; RRID:Addgene_154058)
  • For your References section:

    A heat-shock inducible system for flexible gene expression in cereals. Harrington SA, Backhaus AE, Fox S, Rogers C, Borrill P, Uauy C, Richardson A. Plant Methods. 2020 Oct 14;16:137. doi: 10.1186/s13007-020-00677-3. eCollection 2020. 10.1186/s13007-020-00677-3 PubMed 33072173