Skip to main content

pRibo-Tt
(Plasmid #154124)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154124 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAM552
  • Backbone size w/o insert (bp) 1777
  • Total vector size (bp) 8188
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    E. coli K12 POP2136
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    engineered bacterial rRNAs operon under control of pL promotor
  • Species
    Synthetic
  • Insert Size (bp)
    5525
  • Promoter pL

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtcaggggggcggagcctat
  • 3′ sequencing primer CAG CTC ATT TCA TCA ATA TTT TTT TGA TGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    bacterial tRNAs (Asp, Trp, Ile, Ala, Glu) operon under control of Ptac promoter
  • Species
    Synthetic
  • Insert Size (bp)
    669
  • Promoter Ptac

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggcatcaaattaagcagaaggccat
  • 3′ sequencing primer AAT ACT CAT ACT CTT CCT TTT TCA ATA TTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene QC identified a small discrepancy in the -10 region compared to the reference sequence. The depositor does not believe this to be of functional concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRibo-Tt was a gift from Alexander Mankin (Addgene plasmid # 154124 ; http://n2t.net/addgene:154124 ; RRID:Addgene_154124)
  • For your References section:

    A fully orthogonal system for protein synthesis in bacterial cells. Aleksashin NA, Szal T, d'Aquino AE, Jewett MC, Vazquez-Laslop N, Mankin AS. Nat Commun. 2020 Apr 20;11(1):1858. doi: 10.1038/s41467-020-15756-1. 10.1038/s41467-020-15756-1 PubMed 32313034