pRibo-Tt
(Plasmid
#154124)
-
PurposeExpresses wt Ribo-T rRNA and a set of tRNAs in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154124 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAM552
- Backbone size w/o insert (bp) 1777
- Total vector size (bp) 8188
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)E. coli K12 POP2136
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameengineered bacterial rRNAs operon under control of pL promotor
-
SpeciesSynthetic
-
Insert Size (bp)5525
- Promoter pL
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer gtcaggggggcggagcctat
- 3′ sequencing primer CAG CTC ATT TCA TCA ATA TTT TTT TGA TGG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namebacterial tRNAs (Asp, Trp, Ile, Ala, Glu) operon under control of Ptac promoter
-
SpeciesSynthetic
-
Insert Size (bp)669
- Promoter Ptac
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcatcaaattaagcagaaggccat
- 3′ sequencing primer AAT ACT CAT ACT CTT CCT TTT TCA ATA TTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC identified a small discrepancy in the -10 region compared to the reference sequence. The depositor does not believe this to be of functional concern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRibo-Tt was a gift from Alexander Mankin (Addgene plasmid # 154124 ; http://n2t.net/addgene:154124 ; RRID:Addgene_154124) -
For your References section:
A fully orthogonal system for protein synthesis in bacterial cells. Aleksashin NA, Szal T, d'Aquino AE, Jewett MC, Vazquez-Laslop N, Mankin AS. Nat Commun. 2020 Apr 20;11(1):1858. doi: 10.1038/s41467-020-15756-1. 10.1038/s41467-020-15756-1 PubMed 32313034