-
PurposeSuicidal integration plasmid with the Tn7 arms, streptomycin and kanamycin resistance genes and the restriction site to clone the barcode-carrying cassette.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneR6K gamma pir + dependent origin of replication
- Backbone size w/o insert (bp) 2996
- Total vector size (bp) 4132
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir+
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameleft and right end of Tn7 arm
-
SpeciesTn7
-
Insert Size (bp)444
- Promoter no
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tcttgcggccggccgc
- 3′ sequencing primer ttgaagctagacaggcttatcttgg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSpectinomycin resistant gene
-
Alt namespnR
-
SpeciesStreptomyces spectabilis
-
Insert Size (bp)792
- Promoter Spectinomycin resistance gene promoter
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer agtttggaactagatttcac
- 3′ sequencing primer tcagtccagttatgctgtgaaaaagc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJesse Lerner
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tn7 integration plasmid was a gift from Shimon Bershtein (Addgene plasmid # 154134 ; http://n2t.net/addgene:154134 ; RRID:Addgene_154134) -
For your References section:
Chromosomal barcoding of E. coli populations reveals lineage diversity dynamics at high resolution. Jasinska W, Manhart M, Lerner J, Gauthier L, Serohijos AWR, Bershtein S. Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z. 10.1038/s41559-020-1103-z PubMed 32094541