Tn7 integration plasmid
(Plasmid #154134)

• Purpose: Suicidal integration plasmid with the Tn7 arms, streptomycin and kanamycin resistance genes and the restriction site to clone the barcode-carrying cassette.
• Depositing Lab: Shimon Bershtein
• Publication: Jasinska et al Nat Ecol Evol. 2020 Feb 24. pii: 10.1038/s41559-020-1103-z. doi: 10.1038/s41559-020-1103-z.

Backbone

• Vector backbone: R6K gamma pir + dependent origin of replication
• Backbone size w/o insert (bp): 2996
• Total vector size (bp): 4132
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin and Spectinomycin, 50 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir+
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: left and right end of Tn7 arm
• Species: Tn7
• Insert Size (bp): 444
• Promoter: no

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tcttgcggccggccgc
• 3′ sequencing primer: ttgaagctagacaggcttatcttgg

Gene/Insert 2

• Gene/Insert name: Spectinomycin resistant gene
• Alt name: spnR
• Species: Streptomyces spectabilis
• Insert Size (bp): 792
• Promoter: Spectinomycin resistance gene promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: agtttggaactagatttcac
• 3′ sequencing primer: tcagtccagttatgctgtgaaaaagc

Resource Information

• Supplemental Documents:
  • tn7-integration-plasmid.gb
• A portion of this plasmid was derived from a plasmid made by: Jesse Lerner

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry