pEG01
(Plasmid
#154136)
-
PurposeThis plasmid carries fucO and aldA under the control of P_BAD promoter, which is used for study about Improving ethylene glycol utilization in Escherichia coli fermentation.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMB1-spect-P_BAD
- Backbone size w/o insert (bp) 2583
- Total vector size (bp) 5195
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefucO, aldA
-
SpeciesEscherichia coli str. K-12 substr. MG1655
-
Insert Size (bp)2612
-
GenBank ID947273, 945672
- Promoter P_BAD
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gctaacagaatgattctgaacgaaacg
- 3′ sequencing primer agactgtaaataaaccacctgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG01 was a gift from Kang Zhou (Addgene plasmid # 154136 ; http://n2t.net/addgene:154136 ; RRID:Addgene_154136) -
For your References section:
Improving ethylene glycol utilization in Escherichia coli fermentation. Panda S, Fung V, Zhou J, Liang H, Zhou K. Biochemical Engineering Journal 10.1016/j.bej.2021.107957