Skip to main content

pEG02
(Plasmid #154137)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 154137 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A-cam-P_thrC3
  • Backbone size w/o insert (bp) 2886
  • Total vector size (bp) 5498
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    fucO, aldA
  • Species
    Escherichia coli str. K-12 substr. MG1655
  • Insert Size (bp)
    2612
  • GenBank ID
    947273, 945672
  • Promoter P_thrC3

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gctaacagaatgattctgaacgaaacg
  • 3′ sequencing primer agactgtaaataaaccacctgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEG02 was a gift from Kang Zhou (Addgene plasmid # 154137 ; http://n2t.net/addgene:154137 ; RRID:Addgene_154137)
  • For your References section:

    Improving ethylene glycol utilization in Escherichia coli fermentation. Panda S, Fung V, Zhou J, Liang H, Zhou K. Biochemical Engineering Journal 10.1016/j.bej.2021.107957