pCMV-dLbCpf1-BE-YE2
(Plasmid #154146)

• Purpose: Expresses dLbCpf1-BE-YE2(dLbCas12a-BE-YE2) in mammalian cells.
• Depositing Lab: Jin-Soo Kim
• Publication: Kim et al Nat Commun. 2020 Aug 13;11(1):4072. doi: 10.1038/s41467-020-17889-9.

Backbone

• Vector backbone: pCMV
• Total vector size (bp): 8166
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dLbCpf1-BE-YE2 (dCas12a-BE-YE2)
• Alt name: NLS-APOBEC1(W90Y+R132E)-dLbCpf1(D832A+E925A+D1148A)-NLS-UGI-NLS
• Species: Synthetic; Cpf1(Cas12a) is from Lachnospiraceae bacterium; APOBEC1 is from Rattus norvegicus
• Insert Size (bp): 4764
• Mutation: APOBEC1(W90Y+R132E), dLbCpf1(D832A+E925A+D1148A)
• Promoter: CMV
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)
  • SV40 NLS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-F(CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: BGH-R(TAGAAGGCACAGTCGAGG)

Resource Information

• Supplemental Documents:
  • pCMV-dLbCpf1-BE-YE2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pCMV-dLbCpf1-BE (addgene, #107685) was modified to incorporate combinations of mutations in the APOBEC1 domain.