pCMV-dLbCpf1-BE-YE2
(Plasmid
#154146)
-
PurposeExpresses dLbCpf1-BE-YE2(dLbCas12a-BE-YE2) in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154146 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 8166
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLbCpf1-BE-YE2 (dCas12a-BE-YE2)
-
Alt nameNLS-APOBEC1(W90Y+R132E)-dLbCpf1(D832A+E925A+D1148A)-NLS-UGI-NLS
-
SpeciesSynthetic; Cpf1(Cas12a) is from Lachnospiraceae bacterium; APOBEC1 is from Rattus norvegicus
-
Insert Size (bp)4764
-
MutationAPOBEC1(W90Y+R132E), dLbCpf1(D832A+E925A+D1148A)
- Promoter CMV
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
- SV40 NLS
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV-F(CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer BGH-R(TAGAAGGCACAGTCGAGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCMV-dLbCpf1-BE (addgene, #107685) was modified to incorporate combinations of mutations in the APOBEC1 domain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-dLbCpf1-BE-YE2 was a gift from Jin-Soo Kim (Addgene plasmid # 154146 ; http://n2t.net/addgene:154146 ; RRID:Addgene_154146) -
For your References section:
Genome-wide specificity of dCpf1 cytidine base editors. Kim D, Lim K, Kim DE, Kim JS. Nat Commun. 2020 Aug 13;11(1):4072. doi: 10.1038/s41467-020-17889-9. 10.1038/s41467-020-17889-9 PubMed 32792663